SCF117157, SCF117157 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF117157
Genbank IDKP278837
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)15
Primer 1SCF117157.forward primer: GGATAGAAACCTGATACGGAC
Primer 2SCF117157.reverse primer: CGTTACCGTCCCAAATATAA
Max Length204
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278837
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A15.02SCF117157View
2Cranberry-Mullica_Queen-2007LG1N/A16.8SCF117157View
3Cranberry-CNJ02-1-2017LG01N/A13.7SCF117157View
4Cranberry-Mullica_Queen-2017LG01N/A14.7SCF117157View
5Cranberry-Composite_map-F1LG01N/A102.73SCF117157View
6Cranberry-Mullica_Queen_1-F1LG01N/A88.48SCF117157View
7Cranberry-Mullica_Queen_2-F1LG01N/A105.05SCF117157View
8Cranberry-Stevens-F1LG01N/A83.96SCF117157View