SCF118468, SCF118468 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF118468
Genbank IDKP278840
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)15
Primer 1SCF118468.forward primer: ATAAGCGGAGCACAGTTACA
Primer 2SCF118468.reverse primer: GATAGGATGACCTGTTTTGGT
Max Length260
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG09N/A47SCF118468View
2Cranberry-Crimson_Queen-2007LG9N/A49.2SCF118468View
3Cranberry-Crimson_Queen-2017LG09N/A40SCF118468View
4Cranberry-Mullica_Queen-2007LG9N/A66.7SCF118468View
5Cranberry-Mullica_Queen-2017LG09N/A55.1SCF118468View
6Cranberry-CNJ02-1-2007LG9N/A53.86SCF118468View
7Cranberry-Composite_map-F1LG09N/A44.63SCF118468View
8Cranberry-Crimson_Queen-F1LG09N/A31.04SCF118468View
9Cranberry-Mullica_Queen_1-F1LG09N/A45.34SCF118468View
10Cranberry-Mullica_Queen_2-F1LG09N/A46.1SCF118468View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278840
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF118468.forward primerVaccinium macrocarponprimer
reverse primerSCF118468.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF118468SCF118468Vaccinium macrocarponmarker_locus
SCF118468SCF118468-44.63Vaccinium macrocarponmarker_locus
SCF118468SCF118468-31.04Vaccinium macrocarponmarker_locus
SCF118468SCF118468-45.34Vaccinium macrocarponmarker_locus
SCF118468SCF118468-46.1Vaccinium macrocarponmarker_locus