SCF124322, SCF124322 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF124322
Genbank IDKP278849
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)9
Primer 1SCF124322.forward primer: TAAAACTGTGAGGTTCAATGTG
Primer 2SCF124322.reverse primer: CTTCGTGTCTCAAATTACAAAA
Max Length235
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278849
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A77.97SCF124322View
2Cranberry-Crimson_Queen-2007LG1N/A66.9SCF124322View
3Cranberry-Mullica_Queen-2007LG1N/A89.2SCF124322View
4Cranberry-CNJ02-1-2017LG01N/A73.5SCF124322View
5Cranberry-Crimson_Queen-2017LG01N/A63.3SCF124322View
6Cranberry-Mullica_Queen-2017LG01N/A85.3SCF124322View
7Cranberry-Composite_map-F1LG01N/A31.68SCF124322View
8Cranberry-Crimson_Queen-F1LG01N/A13.11SCF124322View
9Cranberry-Mullica_Queen_1-F1LG01N/A13.71SCF124322View