SCF124927, SCF124927 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF124927
Genbank ID	KP278850
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TG)12
Primer 1	SCF124927.forward primer: CGAGTGTCATTAGCAACAGA
Primer 2	SCF124927.reverse primer: TATCACTTTAGATCGAGCAGAC
Max Length	236
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278850

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold00572	supercontig	scaffold00572:169851..170061 .
chr1_H1	supercontig	chr1_H1:2558784..2558989 .
Vmac_chr06	supercontig	Vmac_chr06:2246484..2246688 .
chr6	supercontig	chr6:35601679..35601883 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG6	N/A	96.87	SCF124927	View
2	Cranberry-Crimson_Queen-2007	LG6	N/A	82.6	SCF124927	View
3	Cranberry-Mullica_Queen-2007	LG6	N/A	113	SCF124927	View
4	Blueberry-F1#10_x_W85-23-F1-2017	LG06	N/A	81.2	SCF124927	View
5	Blueberry-F1#10-2017	LG06	N/A	91	SCF124927	View
6	Blueberry-W85-23-2017	LG06	N/A	107.8	SCF124927	View
7	Cranberry-CNJ02-1-2017	LG06	N/A	83.5	SCF124927	View
8	Cranberry-Crimson_Queen-2017	LG06	N/A	69.9	SCF124927	View
9	Cranberry-Mullica_Queen-2017	LG06	N/A	96.5	SCF124927	View
10	Cranberry-Composite_map-F1	LG06	N/A	3.02	SCF124927	View
11	Cranberry-Crimson_Queen-F1	LG06	N/A	1.19	SCF124927	View
12	Cranberry-Mullica_Queen_1-F1	LG06	N/A	2.38	SCF124927	View