SCF125667, SCF125667 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF125667
Genbank ID	KP278852
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CA)10
Primer 1	SCF125667.forward primer: AAGGGAGACATTACACAACAA
Primer 2	SCF125667.reverse primer: TTCGAGATTGACCAAGTATGT
Max Length	188
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278852

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr02	supercontig	Vmac_chr02:23553537..23553694 .
chr2	supercontig	chr2:23327196..23327353 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG2	N/A	43.5	SCF125667	View
2	Cranberry-CNJ02-1-2007	LG2	N/A	46.35	SCF125667	View
3	Cranberry-Crimson_Queen-2007	LG2	N/A	42.1	SCF125667	View
4	Cranberry-Mullica_Queen-2007	LG2	N/A	52.2	SCF125667	View
5	Blueberry-F1#10_x_W85-23-F1-2017	LG02	N/A	49.3	SCF125667	View
6	Blueberry-F1#10-2017	LG02	N/A	13.3	SCF125667	View
7	Cranberry-CNJ02-1-2017	LG02	N/A	45.9	SCF125667	View
8	Cranberry-Crimson_Queen-2017	LG02	N/A	40.1	SCF125667	View
9	Cranberry-Mullica_Queen-2017	LG02	N/A	48.7	SCF125667	View
10	Cranberry-[BG//BL/BN]95-F1	LG02	N/A	56.51	SCF125667	View
11	Cranberry-Composite_map-F1	LG02	N/A	57.45	SCF125667	View
12	Cranberry-Crimson_Queen-F1	LG02	N/A	60.81	SCF125667	View
13	Cranberry-Mullica_Queen_1-F1	LG02	N/A	67.66	SCF125667	View
14	Cranberry-Mullica_Queen_2-F1	LG02	N/A	68.98	SCF125667	View
15	Cranberry-Stevens-F1	LG02	N/A	46.37	SCF125667	View