SCF125667, SCF125667 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF125667
Genbank IDKP278852
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CA)10
Primer 1SCF125667.forward primer: AAGGGAGACATTACACAACAA
Primer 2SCF125667.reverse primer: TTCGAGATTGACCAAGTATGT
Max Length188
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2017LG02N/A45.9SCF125667ViewN/A
2Cranberry-Mullica_Queen-2017LG02N/A48.7SCF125667ViewN/A
3Cranberry-Mullica_Queen-2007LG2N/A52.2SCF125667ViewN/A
4Blueberry-F1#10_x_W85-23-F1-2017LG02N/A49.3SCF125667ViewN/A
5Blueberry-F1#10-2017LG02N/A13.3SCF125667ViewN/A
6Cranberry-CNJ02-1-2007LG2N/A46.35SCF125667ViewN/A
7Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG2N/A43.5SCF125667ViewN/A
8Cranberry-Crimson_Queen-2017LG02N/A40.1SCF125667ViewN/A
9Cranberry-Crimson_Queen-2007LG2N/A42.1SCF125667ViewN/A
10Cranberry-[BG//BL/BN]95-F1LG02N/A56.51SCF125667ViewN/A
11Cranberry-Composite_map-F1LG02N/A57.45SCF125667ViewN/A
12Cranberry-Crimson_Queen-F1LG02N/A60.81SCF125667ViewN/A
13Cranberry-Mullica_Queen_1-F1LG02N/A67.66SCF125667ViewN/A
14Cranberry-Mullica_Queen_2-F1LG02N/A68.98SCF125667ViewN/A
15Cranberry-Stevens-F1LG02N/A46.37SCF125667ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278852
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF125667.forward primerVaccinium macrocarponprimer
reverse primerSCF125667.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fruit shape: persistent homologyqFSPH.GRYG.LG02.14Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF125667SCF125667Vaccinium macrocarponmarker_locus
SCF125667SCF125667-56.51Vaccinium macrocarponmarker_locus
SCF125667SCF125667-57.45Vaccinium macrocarponmarker_locus
SCF125667SCF125667-60.81Vaccinium macrocarponmarker_locus
SCF125667SCF125667-67.66Vaccinium macrocarponmarker_locus
SCF125667SCF125667-68.98Vaccinium macrocarponmarker_locus
SCF125667SCF125667-46.37Vaccinium macrocarponmarker_locus