SCF118608, SCF118608 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF118608
Genbank IDKP278841
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)14
Primer 1SCF118608.forward primer: AACTACTCGATCTTCACCCTTA
Primer 2SCF118608.reverse primer: AGGAGACCAACACTTAACCTC
Max Length256
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG11N/A75.1SCF118608View
2Cranberry-CNJ02-1-2007LG11N/A82.26SCF118608View
3Cranberry-Crimson_Queen-2017LG11N/A65.4SCF118608View
4Cranberry-Mullica_Queen-2017LG11N/A87.3SCF118608View
5Cranberry-Crimson_Queen-2007LG11N/A74.1SCF118608View
6Cranberry-Mullica_Queen-2007LG11N/A97.5SCF118608View
7Cranberry-Composite_map-F1LG11N/A84.31SCF118608View
8Cranberry-Crimson_Queen-F1LG11N/A78.21SCF118608View
9Cranberry-Mullica_Queen_1-F1LG11N/A96.77SCF118608View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278841
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF118608.forward primerVaccinium macrocarponprimer
reverse primerSCF118608.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit weightqFWT.CNJ02-1.LG11.2011.2Vaccinium macrocarponQTL
fruit weightqFWT.CNJ02-1.LG11.2Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF118608SCF118608Vaccinium macrocarponmarker_locus
SCF118608SCF118608-84.31Vaccinium macrocarponmarker_locus
SCF118608SCF118608-78.21Vaccinium macrocarponmarker_locus
SCF118608SCF118608-96.77Vaccinium macrocarponmarker_locus