scf11l, scf11l (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf11l
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf11l.forward primer: TAATGAGTGCTGGTTCTGCG
Primer 2scf11l.reverse primer: TTCAAATCCACGTCAGCAAA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A37.46scf11lView
2Cranberry-Crimson_Queen-2007LG1N/A33.2scf11lView
3Cranberry-Mullica_Queen-2007LG1N/A40.4scf11lView
4Cranberry-Unifiedmap2013LG9N/A6.7scf11lView
5Cranberry-CNJ02-1-2017LG01N/A32.4scf11lView
6Cranberry-Crimson_Queen-2017LG01N/A31.4scf11lView
7Cranberry-Mullica_Queen-2017LG01N/A32.2scf11lView
8Cranberry-Composite_map-F1LG01N/A76.17scf11lView
9Cranberry-Crimson_Queen-F1LG01N/A48.87scf11lView
10Cranberry-Mullica_Queen_1-F1LG01N/A63.44scf11lView