SCF128307, SCF128307 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF128307
Genbank IDKP278857
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TG)14
Primer 1SCF128307.forward primer: ACTCAGAAGTTGAAGCACAAA
Primer 2SCF128307.reverse primer: GTATCAAGTACACCAACACCAG
Max Length262
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG7N/A31.6SCF128307View
2Cranberry-Mullica_Queen-2017LG07N/A27.1SCF128307View
3Blueberry-F1#10_x_W85-23-F1-2017LG07N/A34.3SCF128307View
4Blueberry-F1#10-2017LG07N/A35.7SCF128307View
5Cranberry-Crimson_Queen-2017LG07N/A28.4SCF128307View
6Cranberry-Crimson_Queen-2007LG7N/A30.3SCF128307View
7Cranberry-CNJ02-1-2017LG07N/A27.2SCF128307View
8Blueberry-W85-23-2017LG07N/A26.1SCF128307View
9Cranberry-CNJ02-1-2007LG7N/A31.1SCF128307View
10Cranberry-Composite_map-F1LG07N/A65.87SCF128307View
11Cranberry-Crimson_Queen-F1LG07N/A59.58SCF128307View
12Cranberry-Mullica_Queen_1-F1LG07N/A78.11SCF128307View
13Cranberry-Mullica_Queen_2-F1LG07N/A82.01SCF128307View
14Cranberry-Stevens-F1LG07N/A58.57SCF128307View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278857
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF128307.forward primerVaccinium macrocarponprimer
reverse primerSCF128307.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF128307SCF128307Vaccinium macrocarponmarker_locus
SCF128307SCF128307-65.87Vaccinium macrocarponmarker_locus
SCF128307SCF128307-59.58Vaccinium macrocarponmarker_locus
SCF128307SCF128307-78.11Vaccinium macrocarponmarker_locus
SCF128307SCF128307-82.01Vaccinium macrocarponmarker_locus
SCF128307SCF128307-58.57Vaccinium macrocarponmarker_locus