SCF128992, SCF128992 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF128992
Genbank IDKP278858
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)11
Primer 1SCF128992.forward primer: GAGTGTTGAGTTATAGGGGTTT
Primer 2SCF128992.reverse primer: TCACAAGAATAGAAGGATGGA
Max Length239
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG03N/A54.9SCF128992View
2Cranberry-Mullica_Queen-2017LG03N/A61.3SCF128992View
3Cranberry-CNJ02-1-2007LG3N/A60.51SCF128992View
4Cranberry-Mullica_Queen-2007LG3N/A70.2SCF128992View
5Cranberry-Composite_map-F1LG03N/A35.34SCF128992View
6Cranberry-Mullica_Queen_1-F1LG03N/A45.95SCF128992View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278858
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF128992.forward primerVaccinium macrocarponprimer
reverse primerSCF128992.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF128992SCF128992Vaccinium macrocarponmarker_locus
SCF128992SCF128992-35.34Vaccinium macrocarponmarker_locus
SCF128992SCF128992-45.95Vaccinium macrocarponmarker_locus