SCF128992, SCF128992 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF128992
Genbank ID	KP278858
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)11
Primer 1	SCF128992.forward primer: GAGTGTTGAGTTATAGGGGTTT
Primer 2	SCF128992.reverse primer: TCACAAGAATAGAAGGATGGA
Max Length	239
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278858

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr03	supercontig	Vmac_chr03:21924428..21924637 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG3	N/A	60.51	SCF128992	View
2	Cranberry-Mullica_Queen-2007	LG3	N/A	70.2	SCF128992	View
3	Cranberry-CNJ02-1-2017	LG03	N/A	54.9	SCF128992	View
4	Cranberry-Mullica_Queen-2017	LG03	N/A	61.3	SCF128992	View
5	Cranberry-Composite_map-F1	LG03	N/A	35.34	SCF128992	View
6	Cranberry-Mullica_Queen_1-F1	LG03	N/A	45.95	SCF128992	View