SCF136207, SCF136207 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF136207
Genbank IDKP278866
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)9
Primer 1SCF136207.forward primer: GTCTCTGTAGTCGGTGCTTT
Primer 2SCF136207.reverse primer: GATTTCGATTCCTTGACACT
Max Length171
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG09N/A61.9SCF136207View
2Blueberry-W85-23-2017LG09N/A53.8SCF136207View
3Blueberry-F1#10_x_W85-23-F1-2017LG09N/A23SCF136207View
4Cranberry-Mullica_Queen-2007LG9N/A72.4SCF136207View
5Cranberry-CNJ02-1-2017LG09N/A53.6SCF136207View
6Cranberry-CNJ02-1-2007LG9N/A59.27SCF136207View
7Cranberry-Crimson_Queen-2007LG9N/A54.5SCF136207View
8Cranberry-Crimson_Queen-2017LG09N/A46.4SCF136207View
9Cranberry-Composite_map-F1LG09N/A37.47SCF136207View
10Cranberry-Crimson_Queen-F1LG09N/A24.49SCF136207View
11Cranberry-Mullica_Queen_1-F1LG09N/A38.18SCF136207View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278866
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF136207.forward primerVaccinium macrocarponprimer
reverse primerSCF136207.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF136207SCF136207Vaccinium macrocarponmarker_locus
SCF136207SCF136207-37.47Vaccinium macrocarponmarker_locus
SCF136207SCF136207-24.49Vaccinium macrocarponmarker_locus
SCF136207SCF136207-38.18Vaccinium macrocarponmarker_locus