SCF132506, SCF132506 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF132506
Genbank IDKP278862
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TCA)10
Primer 1SCF132506.forward primer: AATGTGCCAAGTTTTGTAGAC
Primer 2SCF132506.reverse primer: GTCCCCTATAAGTCATCTGAAA
Max Length282
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG11N/A64.12SCF132506View
2Cranberry-Mullica_Queen-2007LG11N/A58.5SCF132506View
3Cranberry-CNJ02-1-2007LG11N/A49.71SCF132506View
4Cranberry-Mullica_Queen-2017LG11N/A52.7SCF132506View
5Cranberry-CNJ02-1-2017LG11N/A47.3SCF132506View
6Cranberry-[BG//BL/BN]95-F1LG11N/A51.93SCF132506View
7Cranberry-Composite_map-F1LG11N/A50.06SCF132506View
8Cranberry-Mullica_Queen_1-F1LG11N/A59.19SCF132506View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278862
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF132506.forward primerVaccinium macrocarponprimer
reverse primerSCF132506.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF132506SCF132506Vaccinium macrocarponmarker_locus
SCF132506SCF132506-51.93Vaccinium macrocarponmarker_locus
SCF132506SCF132506-50.06Vaccinium macrocarponmarker_locus
SCF132506SCF132506-59.19Vaccinium macrocarponmarker_locus