SCF13711, SCF13711 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF13711
Genbank IDKP278640
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GAG)7
Primer 1SCF13711.forward primer: GACTTCCTTGGTACTTGGTG
Primer 2SCF13711.reverse primer: ACTTTGAGGGTAGGAGTAAACA
Max Length354
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG06N/A73.7SCF13711View
2Blueberry-F1#10-2017LG06N/A60.2SCF13711View
3Cranberry-Mullica_Queen-2007LG6N/A86.7SCF13711View
4Cranberry-Crimson_Queen-2017LG06N/A58.4SCF13711View
5Cranberry-CNJ02-1-2017LG06N/A66.3SCF13711View
6Cranberry-CNJ02-1-2007LG6N/A72.99SCF13711View
7Cranberry-Crimson_Queen-2007LG6N/A64.1SCF13711View
8Blueberry-F1#10_x_W85-23-F1-2017LG06N/A52.1SCF13711View
9Cranberry-Composite_map-F1LG06N/A28.08SCF13711View
10Cranberry-Crimson_Queen-F1LG06N/A23.25SCF13711View
11Cranberry-Mullica_Queen_1-F1LG06N/A26.25SCF13711View
12Cranberry-Stevens-F1LG06N/A31.41SCF13711View
13Cranberry-BB/CQ-F1LG05N/A68.78SCF13711View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278640
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF13711.forward primerVaccinium macrocarponprimer
reverse primerSCF13711.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF13711SCF13711Vaccinium macrocarponmarker_locus
SCF13711SCF13711-28.08Vaccinium macrocarponmarker_locus
SCF13711SCF13711-23.25Vaccinium macrocarponmarker_locus
SCF13711SCF13711-26.25Vaccinium macrocarponmarker_locus
SCF13711SCF13711-31.41Vaccinium macrocarponmarker_locus
SCF13711SCF13711-68.775Vaccinium macrocarponmarker_locus