scf13a, scf13a (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf13a
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(ga)17
Primer 1	scf13a.forward primer: TAGAGGGCGTTGAAAGGAGA
Primer 2	scf13a.reverse primer: CCCCAAATTTCTCCCCATTA
Max Length	300
Publication	[view all]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG1	N/A	61.1	scf13a	View
2	Cranberry-CNJ02-1-2017	LG09	N/A	37.5	scf13a	View
3	Cranberry-Mullica_Queen-2017	LG09	N/A	44	scf13a	View
4	Cranberry-Crimson_Queen-2017	LG09	N/A	31.5	scf13a	View
5	Cranberry-CNJ02-1-2007	LG9	N/A	44.25	scf13a	View
6	Cranberry-Crimson_Queen-2007	LG9	N/A	41	scf13a	View
7	Cranberry-Mullica_Queen-2007	LG9	N/A	54.4	scf13a	View
8	Cranberry-Composite_map-F1	LG09	N/A	56.29	scf13a	View
9	Cranberry-Crimson_Queen-F1	LG09	N/A	39.98	scf13a	View
10	Cranberry-Mullica_Queen_1-F1	LG09	N/A	59.04	scf13a	View
11	Cranberry-BB/CQ-F1	LG01	N/A	55.77	scf13a	View
12	Cranberry-BB/CQ-F1	LG01	N/A	56.96	scf13a	View

Publications


Year	Publication
2011	Georgi L, Herai RH, Vidal R, Falsarella Carazzolle M, Guimarães Pereira G, Polashock J, Vorsa N. Cranberry microsatellite marker development from assembled next-generation genomic sequence. Molecular breeding. 2011.

Relationships

This genetic_marker is adjacent to the following primer feature(s):


Feature Name	Unique Name	Species	Type
forward primer	scf13a.forward primer	Vaccinium macrocarpon	primer
reverse primer	scf13a.reverse primer	Vaccinium macrocarpon	primer

The following marker_locus feature(s) are an instance of this genetic_marker:


Feature Name	Unique Name	Species	Type
scf13a	scf13a	Vaccinium macrocarpon	marker_locus
scf13a	scf13a-56.29	Vaccinium macrocarpon	marker_locus
scf13a	scf13a-39.98	Vaccinium macrocarpon	marker_locus
scf13a	scf13a-59.04	Vaccinium macrocarpon	marker_locus
scf13a	scf13a-55.765	Vaccinium macrocarpon	marker_locus
scf13a	scf13a-56.957	Vaccinium macrocarpon	marker_locus