scf13a, scf13a (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf13a
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(ga)17
Primer 1scf13a.forward primer: TAGAGGGCGTTGAAAGGAGA
Primer 2scf13a.reverse primer: CCCCAAATTTCTCCCCATTA
Max Length300
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Unifiedmap2013LG1N/A61.1scf13aViewN/A
2Cranberry-Mullica_Queen-2017LG09N/A44scf13aViewN/A
3Cranberry-Crimson_Queen-2017LG09N/A31.5scf13aViewN/A
4Cranberry-Crimson_Queen-2007LG9N/A41scf13aViewN/A
5Cranberry-Mullica_Queen-2007LG9N/A54.4scf13aViewN/A
6Cranberry-CNJ02-1-2007LG9N/A44.25scf13aViewN/A
7Cranberry-CNJ02-1-2017LG09N/A37.5scf13aViewN/A
8Cranberry-Composite_map-F1LG09N/A56.29scf13aViewN/A
9Cranberry-Crimson_Queen-F1LG09N/A39.98scf13aViewN/A
10Cranberry-Mullica_Queen_1-F1LG09N/A59.04scf13aViewN/A
11Cranberry-BB/CQ-F1LG01N/A55.77scf13aViewN/A
12Cranberry-BB/CQ-F1LG01N/A56.96scf13aViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf13a.forward primerVaccinium macrocarponprimer
reverse primerscf13a.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf13ascf13aVaccinium macrocarponmarker_locus
scf13ascf13a-56.29Vaccinium macrocarponmarker_locus
scf13ascf13a-39.98Vaccinium macrocarponmarker_locus
scf13ascf13a-59.04Vaccinium macrocarponmarker_locus
scf13ascf13a-55.765Vaccinium macrocarponmarker_locus
scf13ascf13a-56.957Vaccinium macrocarponmarker_locus