SCF138607, SCF138607 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF138607
Genbank IDKP278872
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)17
Primer 1SCF138607.forward primer: CATATAGAATACTGGACGGACA
Primer 2SCF138607.reverse primer: TTCTGCCATCTCCTTTCTC
Max Length215
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278872
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A116.15SCF138607View
2Cranberry-Crimson_Queen-2007LG1N/A100.8SCF138607View
3Cranberry-Mullica_Queen-2007LG1N/A125.7SCF138607View
4Cranberry-Mullica_Queen_2-F1LG01N/A0SCF138607View
5Cranberry-Stevens-F1LG01N/A0SCF138607View
6Cranberry-CNJ02-1-2017LG01N/A105.1SCF138607View
7Cranberry-Crimson_Queen-2017LG01N/A97.2SCF138607View
8Cranberry-Composite_map-F1LG01N/A0.45SCF138607View