SCF138607, SCF138607 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF138607
Genbank IDKP278872
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)17
Primer 1SCF138607.forward primer: CATATAGAATACTGGACGGACA
Primer 2SCF138607.reverse primer: TTCTGCCATCTCCTTTCTC
Max Length215
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2017LG01N/A97.2SCF138607ViewN/A
2Cranberry-Stevens-F1LG01N/A0SCF138607ViewN/A
3Cranberry-CNJ02-1-2007LG1N/A116.15SCF138607ViewN/A
4Cranberry-Mullica_Queen-2007LG1N/A125.7SCF138607ViewN/A
5Cranberry-Crimson_Queen-2007LG1N/A100.8SCF138607ViewN/A
6Cranberry-CNJ02-1-2017LG01N/A105.1SCF138607ViewN/A
7Cranberry-Mullica_Queen_2-F1LG01N/A0SCF138607ViewN/A
8Cranberry-Composite_map-F1LG01N/A0.45SCF138607ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278872
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF138607.forward primerVaccinium macrocarponprimer
reverse primerSCF138607.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF138607SCF138607Vaccinium macrocarponmarker_locus
SCF138607SCF138607-0.45Vaccinium macrocarponmarker_locus