SCF139334, SCF139334 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF139334
Genbank IDKP278874
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GT)10
Primer 1SCF139334.forward primer: GAGGGTCTAATATCTGGTTTCA
Primer 2SCF139334.reverse primer: GAGAAAAGATGGAGCAAAAG
Max Length205
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG6N/A61.7SCF139334View
2Cranberry-Mullica_Queen-2017LG06N/A52.4SCF139334View
3Cranberry-CNJ02-1-2017LG06N/A46.8SCF139334View
4Cranberry-CNJ02-1-2007LG6N/A50.87SCF139334View
5Cranberry-Composite_map-F1LG06N/A47.23SCF139334View
6Cranberry-Mullica_Queen_1-F1LG06N/A53.13SCF139334View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278874
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF139334.forward primerVaccinium macrocarponprimer
reverse primerSCF139334.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF139334SCF139334Vaccinium macrocarponmarker_locus
SCF139334SCF139334-47.23Vaccinium macrocarponmarker_locus
SCF139334SCF139334-53.13Vaccinium macrocarponmarker_locus