SCF145689, SCF145689 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF145689
Genbank IDKP278885
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)13
Primer 1SCF145689.forward primer: GGCATAAGAGTAGACCATGAAC
Primer 2SCF145689.reverse primer: GTACTATAAAATGCTTCCAGCG
Max Length277
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2007LG12N/A4.8SCF145689ViewN/A
2Blueberry-F1#10-2017LG12N/A2.4SCF145689ViewN/A
3Cranberry-Mullica_Queen-2017LG12N/A4.1SCF145689ViewN/A
4Blueberry-F1#10_x_W85-23-F1-2017LG12N/A1.4SCF145689ViewN/A
5Cranberry-Crimson_Queen-2007LG12N/A0SCF145689ViewN/A
6Cranberry-CNJ02-1-2007LG12N/A0SCF145689ViewN/A
7Blueberry-W85-23-2017LG12N/A1.2SCF145689ViewN/A
8Cranberry-CNJ02-1-2017LG12N/A0SCF145689ViewN/A
9Cranberry-Composite_map-F1LG12N/A85.12SCF145689ViewN/A
10Cranberry-Mullica_Queen_1-F1LG12N/A98.14SCF145689ViewN/A
11Cranberry-Mullica_Queen_2-F1LG12N/A69.24SCF145689ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278885
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF145689.forward primerVaccinium macrocarponprimer
reverse primerSCF145689.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF145689SCF145689Vaccinium macrocarponmarker_locus
SCF145689SCF145689-85.12Vaccinium macrocarponmarker_locus
SCF145689SCF145689-98.14Vaccinium macrocarponmarker_locus
SCF145689SCF145689-69.24Vaccinium macrocarponmarker_locus