SCF145739, SCF145739 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF145739
Genbank IDKP278886
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)10
Primer 1SCF145739.forward primer: AAATCCTCCTGTTTTAGACTCC
Primer 2SCF145739.reverse primer: CCTCAAGTCATCATTCCCT
Max Length242
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG04N/A56.2SCF145739View
2Cranberry-CNJ02-1-2007LG4N/A95.38SCF145739View
3Cranberry-CNJ02-1-2017LG04N/A95SCF145739View
4Cranberry-Mullica_Queen-2017LG04N/A106.6SCF145739View
5Cranberry-Crimson_Queen-2007LG4N/A79SCF145739View
6Cranberry-Mullica_Queen-2007LG4N/A99.7SCF145739View
7Cranberry-Composite_map-F1LG04N/A85.1SCF145739View
8Cranberry-Crimson_Queen-F1LG04N/A81SCF145739View
9Cranberry-Mullica_Queen_1-F1LG04N/A112.12SCF145739View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278886
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF145739.forward primerVaccinium macrocarponprimer
reverse primerSCF145739.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF145739SCF145739Vaccinium macrocarponmarker_locus
SCF145739SCF145739-85.1Vaccinium macrocarponmarker_locus
SCF145739SCF145739-81Vaccinium macrocarponmarker_locus
SCF145739SCF145739-112.12Vaccinium macrocarponmarker_locus