scf142e, scf142e (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf142e
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf142e.forward primer: CTACCGAGCTGGTTGAGGAG
Primer 2scf142e.reverse primer: CGAGCGCATAATCATCTTCA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG3N/A26.4scf142eView
2Cranberry-Mullica_Queen-2007LG3N/A36.6scf142eView
3Cranberry-CNJ02-1-2007LG3N/A30.96scf142eView
4Cranberry-Mullica_Queen-2017LG03N/A29.6scf142eView
5Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG3N/A35.1scf142eView
6Cranberry-Unifiedmap2013LG7aN/A23.9scf142eView
7Cranberry-CNJ02-1-2017LG03N/A25.9scf142eView
8Cranberry-Crimson_Queen-2017LG03N/A22.6scf142eView
9Cranberry-[BG//BL/BN]95-F1LG03N/A77.95scf142eView
10Cranberry-Composite_map-F1LG03N/A60.96scf142eView
11Cranberry-Crimson_Queen-F1LG03N/A59.22scf142eView
12Cranberry-Mullica_Queen_1-F1LG03N/A78.09scf142eView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf142e.forward primerVaccinium macrocarponprimer
reverse primerscf142e.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf142escf142eVaccinium macrocarponmarker_locus
scf142escf142e-77.95Vaccinium macrocarponmarker_locus
scf142escf142e-60.96Vaccinium macrocarponmarker_locus
scf142escf142e-59.22Vaccinium macrocarponmarker_locus
scf142escf142e-78.09Vaccinium macrocarponmarker_locus