scf142e, scf142e (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf142e
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf142e.forward primer: CTACCGAGCTGGTTGAGGAG
Primer 2	scf142e.reverse primer: CGAGCGCATAATCATCTTCA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr03	supercontig	Vmac_chr03:9130904..9131193 .
chr3	supercontig	chr3:8988184..8988485 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG3	N/A	35.1	scf142e	View
2	Cranberry-CNJ02-1-2007	LG3	N/A	30.96	scf142e	View
3	Cranberry-Crimson_Queen-2007	LG3	N/A	26.4	scf142e	View
4	Cranberry-Mullica_Queen-2007	LG3	N/A	36.6	scf142e	View
5	Cranberry-Unifiedmap2013	LG7a	N/A	23.9	scf142e	View
6	Cranberry-CNJ02-1-2017	LG03	N/A	25.9	scf142e	View
7	Cranberry-Crimson_Queen-2017	LG03	N/A	22.6	scf142e	View
8	Cranberry-Mullica_Queen-2017	LG03	N/A	29.6	scf142e	View
9	Cranberry-[BG//BL/BN]95-F1	LG03	N/A	77.95	scf142e	View
10	Cranberry-Composite_map-F1	LG03	N/A	60.96	scf142e	View
11	Cranberry-Crimson_Queen-F1	LG03	N/A	59.22	scf142e	View
12	Cranberry-Mullica_Queen_1-F1	LG03	N/A	78.09	scf142e	View