SCF134365, SCF134365 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF134365
Genbank ID	KP279079
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CTT)8
Primer 1	SCF134365.forward primer: GCCTTGTTATGTTACCTGTGA
Primer 2	SCF134365.reverse primer: ACAACTATCTGGAAAAGGGTT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279079

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr9_H1	supercontig	chr9_H1:42691838..42692045 .
Vmac_chr05	supercontig	Vmac_chr05:34748460..34748671 .
chr7	supercontig	chr7:34960247..34960458 .
Chr09	supercontig	Chr09:1702862..1703068 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.