SCF143318, SCF143318 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF143318
Genbank IDKP278883
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)12
Primer 1SCF143318.forward primer: CCGTGCTTAAATTCTGTAGTG
Primer 2SCF143318.reverse primer: TCATCCATAGGAGAACATCC
Max Length300
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG05N/A0SCF143318View
2Cranberry-CNJ02-1-2017LG05N/A0SCF143318View
3Cranberry-Mullica_Queen_1-F1LG05N/A0SCF143318View
4Cranberry-Mullica_Queen-2017LG05N/A0SCF143318View
5Cranberry-Mullica_Queen-2007LG5N/A0.5SCF143318View
6Cranberry-Crimson_Queen-2007LG5N/A0.4SCF143318View
7Cranberry-CNJ02-1-2007LG5N/A0SCF143318View
8Cranberry-Composite_map-F1LG05N/A0SCF143318View
9Cranberry-Crimson_Queen-F1LG05N/A0SCF143318View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278883
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF143318.forward primerVaccinium macrocarponprimer
reverse primerSCF143318.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF143318SCF143318Vaccinium macrocarponmarker_locus