SCF14877, SCF14877 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF14877
Genbank ID	KP278985
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TG)10
Primer 1	SCF14877.forward primer: CCCATGATCCTATGTATGCT
Primer 2	SCF14877.reverse primer: AGCTCTGATACCAAACTGTCAT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278985

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr09	supercontig	Vmac_chr09:5432717..5433047 .
chr9	supercontig	chr9:35562368..35562680 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.