SCF150898, SCF150898 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF150898
Genbank IDKP278895
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)11
Primer 1SCF150898.forward primer: AAGCTCCATGTATGCGTATC
Primer 2SCF150898.reverse primer: ACACTGACTAGCGTTTGTTGT
Max Length317
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG7N/A12SCF150898View
2Cranberry-CNJ02-1-2007LG7N/A10.52SCF150898View
3Cranberry-Crimson_Queen-2017LG07N/A4.5SCF150898View
4Cranberry-CNJ02-1-2017LG07N/A5.9SCF150898View
5Cranberry-Crimson_Queen-2007LG7N/A8.3SCF150898View
6Cranberry-Mullica_Queen-2017LG07N/A6.9SCF150898View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278895
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF150898.forward primerVaccinium macrocarponprimer
reverse primerSCF150898.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF150898SCF150898Vaccinium macrocarponmarker_locus