SCF153094, SCF153094 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF153094
Genbank IDKP278897
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)9
Primer 1SCF153094.forward primer: TGTCATTAGGGTTCCTCAAA
Primer 2SCF153094.reverse primer: CACCTAGACAACATCGAAACTA
Max Length235
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG03N/A11.9SCF153094View
2Cranberry-Mullica_Queen-2007LG3N/A17.6SCF153094View
3Cranberry-CNJ02-1-2007LG3N/A15.1SCF153094View
4Cranberry-Mullica_Queen-2017LG03N/A14.8SCF153094View
5Cranberry-Composite_map-F1LG03N/A74.7SCF153094View
6Cranberry-Mullica_Queen_1-F1LG03N/A98.06SCF153094View
7Cranberry-BB/CQ-F1LG07N/A16.79SCF153094View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278897
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF153094.forward primerVaccinium macrocarponprimer
reverse primerSCF153094.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF153094SCF153094Vaccinium macrocarponmarker_locus
SCF153094SCF153094-74.7Vaccinium macrocarponmarker_locus
SCF153094SCF153094-98.06Vaccinium macrocarponmarker_locus
SCF153094SCF153094-16.786Vaccinium macrocarponmarker_locus