SCF153722, SCF153722 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Genbank IDKP278899
SpeciesVaccinium macrocarpon
Repeat Motif(TC)11
Primer 1SCF153722.forward primer: AGTTATGAGGCTTACGAGGAG
Primer 2SCF153722.reverse primer: GATGGAACGATGAAACTGAT
Max Length279
Publication[view all]
External references for this genetic_marker
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer