SCF153722, SCF153722 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF153722
Genbank IDKP278899
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)11
Primer 1SCF153722.forward primer: AGTTATGAGGCTTACGAGGAG
Primer 2SCF153722.reverse primer: GATGGAACGATGAAACTGAT
Max Length279
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2007LG1N/A0SCF153722ViewN/A
2Cranberry-CNJ02-1-2017LG01N/A1.1SCF153722ViewN/A
3Cranberry-Mullica_Queen-2017LG01N/A0SCF153722ViewN/A
4Cranberry-CNJ02-1-2007LG1N/A0.93SCF153722ViewN/A
5Cranberry-Crimson_Queen-2017LG01N/A0SCF153722ViewN/A
6Cranberry-Mullica_Queen-2007LG1N/A0SCF153722ViewN/A
7Cranberry-Composite_map-F1LG01N/A113.92SCF153722ViewN/A
8Cranberry-Crimson_Queen-F1LG01N/A79.29SCF153722ViewN/A
9Cranberry-Mullica_Queen_1-F1LG01N/A106.98SCF153722ViewN/A
10Cranberry-Mullica_Queen_2-F1LG01N/A117.07SCF153722ViewN/A
11Cranberry-Stevens-F1LG01N/A89.93SCF153722ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278899
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF153722.forward primerVaccinium macrocarponprimer
reverse primerSCF153722.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF153722SCF153722Vaccinium macrocarponmarker_locus
SCF153722SCF153722-113.92Vaccinium macrocarponmarker_locus
SCF153722SCF153722-79.29Vaccinium macrocarponmarker_locus
SCF153722SCF153722-106.98Vaccinium macrocarponmarker_locus
SCF153722SCF153722-117.07Vaccinium macrocarponmarker_locus
SCF153722SCF153722-89.93Vaccinium macrocarponmarker_locus