SCF155637, SCF155637 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF155637
Genbank IDKP278901
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AT)13
Primer 1SCF155637.forward primer: TGTTAGTGTTAGGACCCGTTA
Primer 2SCF155637.reverse primer: AAAGTAGGAGTTAGGATGGGAT
Max Length224
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG7N/A2.8SCF155637View
2Cranberry-Mullica_Queen-2017LG07N/A0SCF155637View
3Cranberry-Crimson_Queen-2017LG07N/A1.8SCF155637View
4Cranberry-CNJ02-1-2017LG07N/A1.1SCF155637View
5Cranberry-CNJ02-1-2007LG7N/A3.56SCF155637View
6Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG7N/A114.04SCF155637View
7Cranberry-Crimson_Queen-2007LG7N/A4.4SCF155637View
8Cranberry-Composite_map-F1LG07N/A90.38SCF155637View
9Cranberry-Crimson_Queen-F1LG07N/A87.58SCF155637View
10Cranberry-GH1/35-F1LG07N/A85.4SCF155637View
11Cranberry-Mullica_Queen_1-F1LG07N/A106.44SCF155637View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278901
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF155637.forward primerVaccinium macrocarponprimer
reverse primerSCF155637.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF155637SCF155637Vaccinium macrocarponmarker_locus
SCF155637SCF155637-90.38Vaccinium macrocarponmarker_locus
SCF155637SCF155637-87.58Vaccinium macrocarponmarker_locus
SCF155637SCF155637-85.4Vaccinium macrocarponmarker_locus
SCF155637SCF155637-106.44Vaccinium macrocarponmarker_locus