SCF155797, SCF155797 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF155797
Genbank IDKP278902
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)9
Primer 1SCF155797.forward primer: ATCATTAAGGCTCCCAAAG
Primer 2SCF155797.reverse primer: GTACGTCTACTCTGACGGCTA
Max Length188
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG09N/A15.6SCF155797View
2Cranberry-Mullica_Queen-2017LG09N/A18.4SCF155797View
3Cranberry-Mullica_Queen-2007LG9N/A29.9SCF155797View
4Cranberry-Crimson_Queen-2017LG09N/A12.4SCF155797View
5Cranberry-CNJ02-1-2007LG9N/A28.46SCF155797View
6Cranberry-Crimson_Queen-2007LG9N/A27.9SCF155797View
7Cranberry-Composite_map-F1LG09N/A71.69SCF155797View
8Cranberry-Crimson_Queen-F1LG09N/A51.29SCF155797View
9Cranberry-Mullica_Queen_1-F1LG09N/A79.9SCF155797View
10Cranberry-Mullica_Queen_2-F1LG09N/A70.31SCF155797View
11Cranberry-Stevens-F1LG09N/A56.06SCF155797View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278902
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF155797.forward primerVaccinium macrocarponprimer
reverse primerSCF155797.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF155797SCF155797Vaccinium macrocarponmarker_locus
SCF155797SCF155797-71.69Vaccinium macrocarponmarker_locus
SCF155797SCF155797-51.29Vaccinium macrocarponmarker_locus
SCF155797SCF155797-79.9Vaccinium macrocarponmarker_locus
SCF155797SCF155797-70.31Vaccinium macrocarponmarker_locus
SCF155797SCF155797-56.06Vaccinium macrocarponmarker_locus