SCF15729, SCF15729 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF15729
Genbank IDKP278988
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)13
Primer 1SCF15729.forward primer: GAACTGGCTCACTAAAAGAACT
Primer 2SCF15729.reverse primer: GGTGCATAGCGATCTTACTATT
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278988
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF15729.forward primerVaccinium macrocarponprimer
reverse primerSCF15729.reverse primerVaccinium macrocarponprimer