SCF15729, SCF15729 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF15729
Genbank ID	KP278988
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)13
Primer 1	SCF15729.forward primer: GAACTGGCTCACTAAAAGAACT
Primer 2	SCF15729.reverse primer: GGTGCATAGCGATCTTACTATT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278988

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr03	supercontig	Vmac_chr03:33361704..33361850 .
chr3	supercontig	chr3:32449722..32449866 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.