SCF157992, SCF157992 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF157992
Genbank IDKP278904
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TTG)9
Primer 1SCF157992.forward primer: TAGGTTTGTCTCTTATCCATCC
Primer 2SCF157992.reverse primer: GAGTTTGTGATTTCTTAGGAGC
Max Length272
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG3N/A18SCF157992View
2Cranberry-Crimson_Queen-2017LG03N/A14.3SCF157992View
3Cranberry-CNJ02-1-2007LG3N/A19.98SCF157992View
4Cranberry-CNJ02-1-2017LG03N/A15.5SCF157992View
5Cranberry-Mullica_Queen-2017LG03N/A17.1SCF157992View
6Cranberry-Mullica_Queen-2007LG3N/A22.1SCF157992View
7Cranberry-Composite_map-F1LG03N/A70.52SCF157992View
8Cranberry-Crimson_Queen-F1LG03N/A69.35SCF157992View
9Cranberry-Mullica_Queen_1-F1LG03N/A93.88SCF157992View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278904
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF157992.forward primerVaccinium macrocarponprimer
reverse primerSCF157992.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF157992SCF157992Vaccinium macrocarponmarker_locus
SCF157992SCF157992-70.52Vaccinium macrocarponmarker_locus
SCF157992SCF157992-69.35Vaccinium macrocarponmarker_locus
SCF157992SCF157992-93.88Vaccinium macrocarponmarker_locus