SCF15845, SCF15845 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF15845
Genbank IDKP278645
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)10
Primer 1SCF15845.forward primer: AGGCTAATGAAGAAGAAGTCTG
Primer 2SCF15845.reverse primer: GACCAAGACAAGATGAACAAG
Max Length328
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG4N/A55.57SCF15845View
2Cranberry-Mullica_Queen-2017LG04N/A55.9SCF15845View
3Cranberry-Mullica_Queen-2007LG4N/A59.6SCF15845View
4Cranberry-CNJ02-1-2017LG04N/A55.7SCF15845View
5Cranberry-Crimson_Queen-2017LG04N/A24.6SCF15845View
6Cranberry-Crimson_Queen-2007LG4N/A51.3SCF15845View
7Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG4N/A59.72SCF15845View
8Cranberry-[BG//BL/BN]95-F1LG04N/A46.85SCF15845View
9Cranberry-Composite_map-F1LG04N/A41.47SCF15845View
10Cranberry-Crimson_Queen-F1LG04N/A45.22SCF15845View
11Cranberry-GH1/35-F1LG04N/A40.32SCF15845View
12Cranberry-Mullica_Queen_1-F1LG04N/A61.43SCF15845View
13Cranberry-Mullica_Queen_2-F1LG04N/A46.41SCF15845View
14Cranberry-Stevens-F1LG04N/A25.4SCF15845View
15Cranberry-BB/CQ-F1LG02N/A67.14SCF15845View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278645
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF15845.forward primerVaccinium macrocarponprimer
reverse primerSCF15845.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF15845SCF15845Vaccinium macrocarponmarker_locus
SCF15845SCF15845-46.85Vaccinium macrocarponmarker_locus
SCF15845SCF15845-41.47Vaccinium macrocarponmarker_locus
SCF15845SCF15845-45.22Vaccinium macrocarponmarker_locus
SCF15845SCF15845-40.32Vaccinium macrocarponmarker_locus
SCF15845SCF15845-61.43Vaccinium macrocarponmarker_locus
SCF15845SCF15845-46.41Vaccinium macrocarponmarker_locus
SCF15845SCF15845-25.4Vaccinium macrocarponmarker_locus
SCF15845SCF15845-67.14Vaccinium macrocarponmarker_locus