SCF163134, SCF163134 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF163134
Genbank IDKP278914
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)12
Primer 1SCF163134.forward primer: CAGTGCAATTAGTTTCCTATCC
Primer 2SCF163134.reverse primer: TTCTTGGGTTGGTTATTCAG
Max Length233
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG09N/A0.9SCF163134View
2Cranberry-CNJ02-1-2017LG09N/A1.3SCF163134View
3Cranberry-CNJ02-1-2007LG9N/A6.83SCF163134View
4Cranberry-Mullica_Queen-2007LG9N/A5.7SCF163134View
5Cranberry-Composite_map-F1LG09N/A88.51SCF163134View
6Cranberry-Mullica_Queen_1-F1LG09N/A103.14SCF163134View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278914
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF163134.forward primerVaccinium macrocarponprimer
reverse primerSCF163134.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF163134SCF163134Vaccinium macrocarponmarker_locus
SCF163134SCF163134-88.51Vaccinium macrocarponmarker_locus
SCF163134SCF163134-103.14Vaccinium macrocarponmarker_locus