SCF158988, SCF158988 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF158988
Genbank IDKP278907
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)10
Primer 1SCF158988.forward primer: CTCTCACCAAAATCACCATTAG
Primer 2SCF158988.reverse primer: CAAGTATCAAGTTTTAGACGGG
Max Length264
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG2N/A69.3SCF158988View
2Cranberry-Crimson_Queen-2017LG02N/A53SCF158988View
3Cranberry-CNJ02-1-2017LG02N/A59.6SCF158988View
4Cranberry-Crimson_Queen-2007LG2N/A55.7SCF158988View
5Cranberry-Mullica_Queen-2017LG02N/A64.3SCF158988View
6Cranberry-CNJ02-1-2007LG2N/A61.82SCF158988View
7Cranberry-Composite_map-F1LG02N/A39.72SCF158988View
8Cranberry-Crimson_Queen-F1LG02N/A44.11SCF158988View
9Cranberry-Mullica_Queen_1-F1LG02N/A49.06SCF158988View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278907
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF158988.forward primerVaccinium macrocarponprimer
reverse primerSCF158988.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF158988SCF158988Vaccinium macrocarponmarker_locus
SCF158988SCF158988-39.72Vaccinium macrocarponmarker_locus
SCF158988SCF158988-44.11Vaccinium macrocarponmarker_locus
SCF158988SCF158988-49.06Vaccinium macrocarponmarker_locus