SCF16359, SCF16359 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF16359
Genbank IDKP278647
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)12
Primer 1SCF16359.forward primer: GAAGTGCTTTTCTTTCGTAGAG
Primer 2SCF16359.reverse primer: AGACAGATTAAGATCCACCTTG
Max Length328
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG4N/A65.4SCF16359View
2Cranberry-CNJ02-1-2017LG04N/A77.9SCF16359View
3Blueberry-F1#10-2017LG04N/A61.5SCF16359View
4Blueberry-W85-23-2017LG04N/A53.1SCF16359View
5Cranberry-Crimson_Queen-2017LG04N/A41SCF16359View
6Blueberry-F1#10_x_W85-23-F1-2017LG04N/A52.6SCF16359View
7Cranberry-CNJ02-1-2007LG4N/A73.73SCF16359View
8Cranberry-Composite_map-F1LG04N/A56.42SCF16359View
9Cranberry-Crimson_Queen-F1LG04N/A60.17SCF16359View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278647
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF16359.forward primerVaccinium macrocarponprimer
reverse primerSCF16359.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF16359SCF16359Vaccinium macrocarponmarker_locus
SCF16359SCF16359-56.42Vaccinium macrocarponmarker_locus
SCF16359SCF16359-60.17Vaccinium macrocarponmarker_locus