SCF172906, SCF172906 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF172906
Genbank IDKP278923
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)10
Primer 1SCF172906.forward primer: CTGTTCAAGGATTTGTACTGG
Primer 2SCF172906.reverse primer: TATTGACATGAGAAGCACGA
Max Length179
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG10N/A51.8SCF172906View
2Cranberry-Crimson_Queen-2017LG10N/A47.6SCF172906View
3Cranberry-CNJ02-1-2017LG10N/A47.5SCF172906View
4Cranberry-CNJ02-1-2007LG10N/A57.64SCF172906View
5Cranberry-Crimson_Queen-2007LG10N/A48.8SCF172906View
6Cranberry-Mullica_Queen-2007LG10N/A65.9SCF172906View
7Cranberry-Composite_map-F1LG10N/A31.73SCF172906View
8Cranberry-Crimson_Queen-F1LG10N/A31.03SCF172906View
9Cranberry-Mullica_Queen_1-F1LG10N/A28.66SCF172906View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278923
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF172906.forward primerVaccinium macrocarponprimer
reverse primerSCF172906.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit weightqFWT.CNJ02-1.LG10.2012Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF172906SCF172906Vaccinium macrocarponmarker_locus
SCF172906SCF172906-31.73Vaccinium macrocarponmarker_locus
SCF172906SCF172906-31.03Vaccinium macrocarponmarker_locus
SCF172906SCF172906-28.66Vaccinium macrocarponmarker_locus