SCF164915, SCF164915 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF164915
Genbank IDKP278915
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AC)12
Primer 1SCF164915.forward primer: CTCAAAGTATCTCACTCACGC
Primer 2SCF164915.reverse primer: ACTGTTGTCCCCTCTGACTAC
Max Length211
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG6N/A4.5SCF164915View
2Cranberry-CNJ02-1-2017LG06N/A2.6SCF164915View
3Cranberry-CNJ02-1-2007LG6N/A7.05SCF164915View
4Cranberry-Crimson_Queen-2017LG06N/A0.9SCF164915View
5Cranberry-Composite_map-F1LG06N/A83.12SCF164915View
6Cranberry-Crimson_Queen-F1LG06N/A78.28SCF164915View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278915
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF164915.forward primerVaccinium macrocarponprimer
reverse primerSCF164915.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF164915SCF164915Vaccinium macrocarponmarker_locus
SCF164915SCF164915-83.12Vaccinium macrocarponmarker_locus
SCF164915SCF164915-78.28Vaccinium macrocarponmarker_locus