scf1655c, scf1655c (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf1655c
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf1655c.forward primer: CATCTATTGATCAGCCGCAA
Primer 2scf1655c.reverse primer: ACGACCATATGAGCCGAGTT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2007LG9N/A4.5scf1655cViewN/A
2Cranberry-Crimson_Queen-2017LG09N/A0scf1655cViewN/A
3Cranberry-Unifiedmap2013LG1N/A102.8scf1655cViewN/A
4Cranberry-CNJ02-1-2017LG09N/A0scf1655cViewN/A
5Cranberry-CNJ02-1-2007LG9N/A5.34scf1655cViewN/A
6Cranberry-Mullica_Queen-2017LG09N/A0scf1655cViewN/A
7Cranberry-Crimson_Queen-2007LG9N/A6.1scf1655cViewN/A
8Cranberry-Composite_map-F1LG09N/A88.51scf1655cViewN/A
9Cranberry-Crimson_Queen-F1LG09N/A68.57scf1655cViewN/A
10Cranberry-Mullica_Queen_1-F1LG09N/A103.14scf1655cViewN/A
11Cranberry-Mullica_Queen_2-F1LG09N/A96.02scf1655cViewN/A
12Cranberry-Stevens-F1LG09N/A69.5scf1655cViewN/A
13Cranberry-BB/CQ-F1LG01N/A102.87scf1655cViewN/A
14Cranberry-BB/CQ-F1LG01N/A89.96scf1655cViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf1655c.forward primerVaccinium macrocarponprimer
reverse primerscf1655c.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf1655cscf1655cVaccinium macrocarponmarker_locus
scf1655cscf1655c-88.51Vaccinium macrocarponmarker_locus
scf1655cscf1655c-68.57Vaccinium macrocarponmarker_locus
scf1655cscf1655c-103.14Vaccinium macrocarponmarker_locus
scf1655cscf1655c-96.02Vaccinium macrocarponmarker_locus
scf1655cscf1655c-69.5Vaccinium macrocarponmarker_locus
scf1655cscf1655c-102.868Vaccinium macrocarponmarker_locus
scf1655cscf1655c-89.955Vaccinium macrocarponmarker_locus