scf1594, scf1594 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf1594
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf1594.forward primer: ATGCGAATGGAGAAATCTGG
Primer 2	scf1594.reverse primer: ATACCGCAAATGGAGTCTGC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr12	supercontig	Vcev1_p0.Chr12:944836..945000 .
Vmac_chr07	supercontig	Vmac_chr07:730510..730650 .
chr7	supercontig	chr7:141535..141674 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG7	N/A	98.83	scf1594	View
2	Cranberry-Crimson_Queen-2007	LG7	N/A	87.3	scf1594	View
3	Cranberry-Mullica_Queen-2007	LG7	N/A	113.5	scf1594	View
4	Cranberry-Unifiedmap2013	LG3	N/A	100.1	scf1594	View
5	Cranberry-Composite_map-F1	LG07	N/A	0	scf1594	View
6	Cranberry-Crimson_Queen-F1	LG07	N/A	0	scf1594	View
7	Cranberry-Mullica_Queen_1-F1	LG07	N/A	0	scf1594	View
8	Blueberry-F1#10_x_W85-23-F1-2017	LG07	N/A	80.1	scf1594	View
9	Blueberry-F1#10-2017	LG07	N/A	82.4	scf1594	View
10	Cranberry-CNJ02-1-2017	LG07	N/A	74	scf1594	View
11	Cranberry-Crimson_Queen-2017	LG07	N/A	76.6	scf1594	View
12	Cranberry-Mullica_Queen-2017	LG07	N/A	103.5	scf1594	View