scf15b, scf15b (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf15b
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf15b.forward primer: CTGCCTTGTTTCCCTCTCTG
Primer 2	scf15b.reverse primer: GGATTGGTTTGTTGGTCGTC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr12	supercontig	Vmac_chr12:28194659..28195049 .
chr12	supercontig	chr12:27114500..27114889 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG6	N/A	22.7	scf15b	View
2	Cranberry-Composite_map-F1	LG12	N/A	62.39	scf15b	View
3	Cranberry-Stevens-F1	LG12	N/A	51.23	scf15b	View