SCF16166, SCF16166 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF16166
Genbank IDKP278646
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AC)15
Primer 1SCF16166.forward primer: CCTAGTCATTCTTCTACTCCCA
Primer 2SCF16166.reverse primer: GGGTTATCTCGTCCATATTGT
Max Length322
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG12N/A37.54SCF16166View
2Cranberry-CNJ02-1-2017LG12N/A35SCF16166View
3Cranberry-Mullica_Queen-2017LG12N/A41.7SCF16166View
4Cranberry-Mullica_Queen-2007LG12N/A44.2SCF16166View
5Cranberry-Crimson_Queen-2007LG12N/A34.2SCF16166View
6Cranberry-Crimson_Queen-2017LG12N/A28SCF16166View
7Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG12N/A61.9SCF16166View
8Cranberry-[BG//BL/BN]95-F1LG12N/A55.2SCF16166View
9Cranberry-Composite_map-F1LG12N/A56.43SCF16166View
10Cranberry-Crimson_Queen-F1LG12N/A32.89SCF16166View
11Cranberry-GH1/35-F1LG12N/A52.76SCF16166View
12Cranberry-Mullica_Queen_1-F1LG12N/A56.69SCF16166View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278646
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF16166.forward primerVaccinium macrocarponprimer
reverse primerSCF16166.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF16166SCF16166Vaccinium macrocarponmarker_locus
SCF16166SCF16166-55.2Vaccinium macrocarponmarker_locus
SCF16166SCF16166-56.43Vaccinium macrocarponmarker_locus
SCF16166SCF16166-32.89Vaccinium macrocarponmarker_locus
SCF16166SCF16166-52.76Vaccinium macrocarponmarker_locus
SCF16166SCF16166-56.69Vaccinium macrocarponmarker_locus