SCF16186, SCF16186 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF16186
Genbank ID	KP278989
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)10
Primer 1	SCF16186.forward primer: CTTGTATCAACTTCCATCGTCT
Primer 2	SCF16186.reverse primer: CCAAAACCTGAGAAACTTAGAG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278989

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold01029	supercontig	scaffold01029:59500..59846 .
chr5_H1	supercontig	chr5_H1:32929403..32929638 .
Vmac_chr12	supercontig	Vmac_chr12:25493064..25493281 .
chr12	supercontig	chr12:24440495..24440710 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.