SCF18709, SCF18709 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF18709
Genbank IDKP278651
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AC)12
Primer 1SCF18709.forward primer: GTAATGGTAAGTGTCGAAATCC
Primer 2SCF18709.reverse primer: CATAGATGTAACCACGCTTCT
Max Length350
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2017LG02N/A48.2SCF18709ViewN/A
2Cranberry-Crimson_Queen-2017LG02N/A43.3SCF18709ViewN/A
3Cranberry-Stevens-F1LG02N/A43.38SCF18709ViewN/A
4Cranberry-CNJ02-1-2007LG2N/A50.35SCF18709ViewN/A
5Cranberry-Mullica_Queen-2007LG2N/A55.6SCF18709ViewN/A
6Cranberry-Mullica_Queen-2017LG02N/A50.5SCF18709ViewN/A
7Cranberry-Crimson_Queen-2007LG2N/A46.7SCF18709ViewN/A
8Cranberry-Composite_map-F1LG02N/A54.15SCF18709ViewN/A
9Cranberry-Crimson_Queen-F1LG02N/A56.65SCF18709ViewN/A
10Cranberry-Mullica_Queen_1-F1LG02N/A65.28SCF18709ViewN/A
11Cranberry-Mullica_Queen_2-F1LG02N/A61.51SCF18709ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278651
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF18709.forward primerVaccinium macrocarponprimer
reverse primerSCF18709.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF18709SCF18709Vaccinium macrocarponmarker_locus
SCF18709SCF18709-54.15Vaccinium macrocarponmarker_locus
SCF18709SCF18709-56.65Vaccinium macrocarponmarker_locus
SCF18709SCF18709-65.28Vaccinium macrocarponmarker_locus
SCF18709SCF18709-61.51Vaccinium macrocarponmarker_locus
SCF18709SCF18709-43.38Vaccinium macrocarponmarker_locus