SCF187979, SCF187979 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF187979
Genbank IDKP278935
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)10
Primer 1SCF187979.forward primer: AGATAAGGCACCCGATAATAC
Primer 2SCF187979.reverse primer: GATCAAGGAACGCAAATCT
Max Length269
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG07N/A18.5SCF187979View
2Cranberry-Crimson_Queen-2017LG07N/A13.8SCF187979View
3Cranberry-Mullica_Queen-2007LG7N/A20.5SCF187979View
4Cranberry-Mullica_Queen-2017LG07N/A23.9SCF187979View
5Cranberry-CNJ02-1-2007LG7N/A19.28SCF187979View
6Cranberry-Crimson_Queen-2007LG7N/A17.9SCF187979View
7Cranberry-Composite_map-F1LG07N/A76.89SCF187979View
8Cranberry-Crimson_Queen-F1LG07N/A72.69SCF187979View
9Cranberry-Mullica_Queen_1-F1LG07N/A88.66SCF187979View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278935
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF187979.forward primerVaccinium macrocarponprimer
reverse primerSCF187979.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF187979SCF187979Vaccinium macrocarponmarker_locus
SCF187979SCF187979-76.89Vaccinium macrocarponmarker_locus
SCF187979SCF187979-72.69Vaccinium macrocarponmarker_locus
SCF187979SCF187979-88.66Vaccinium macrocarponmarker_locus