SCF171768, SCF171768 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF171768
Genbank ID	KP279094
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(AG)13
Primer 1	SCF171768.forward primer: GTATCCCCTTATACAACCTGC
Primer 2	SCF171768.reverse primer: GGCTTCTATTATTCTATTGCCC
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279094

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr07	supercontig	Vmac_chr07:32057174..32057364 .
chr7	supercontig	chr7:31174513..31174697 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.