SCF172019, SCF172019 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF172019
Genbank IDKP278920
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)14
Primer 1SCF172019.forward primer: TGTGAGTAGTTGTTGAAGGGA
Primer 2SCF172019.reverse primer: CCTCGAAAATCCGGTAAAT
Max Length279
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2007LG1N/A2.1SCF172019ViewN/A
2Cranberry-CNJ02-1-2007LG1N/A2.19SCF172019ViewN/A
3Cranberry-CNJ02-1-2017LG01N/A1.1SCF172019ViewN/A
4Cranberry-Crimson_Queen-2007LG1N/A0.6SCF172019ViewN/A
5Cranberry-Mullica_Queen-2017LG01N/A0SCF172019ViewN/A
6Cranberry-Crimson_Queen-2017LG01N/A0SCF172019ViewN/A
7Cranberry-Composite_map-F1LG01N/A113.92SCF172019ViewN/A
8Cranberry-Crimson_Queen-F1LG01N/A79.29SCF172019ViewN/A
9Cranberry-Mullica_Queen_1-F1LG01N/A106.98SCF172019ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278920
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF172019.forward primerVaccinium macrocarponprimer
reverse primerSCF172019.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF172019SCF172019Vaccinium macrocarponmarker_locus
SCF172019SCF172019-113.92Vaccinium macrocarponmarker_locus
SCF172019SCF172019-79.29Vaccinium macrocarponmarker_locus
SCF172019SCF172019-106.98Vaccinium macrocarponmarker_locus