SCF191642, SCF191642 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF191642
Genbank IDKP278939
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CA)10
Primer 1SCF191642.forward primer: CTACATCCACTAAATATCAAGGC
Primer 2SCF191642.reverse primer: GATCAAGCCAAAGGAAGAA
Max Length230
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-GH1/35-F1LG09N/A85.6SCF191642View
2Cranberry-Composite_map-F1LG09N/A87.38SCF191642View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278939
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF191642.forward primerVaccinium macrocarponprimer
reverse primerSCF191642.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF191642SCF191642-87.38Vaccinium macrocarponmarker_locus
SCF191642SCF191642-85.6Vaccinium macrocarponmarker_locus