SCF173212, SCF173212 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF173212
Genbank IDKP278924
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)9
Primer 1SCF173212.forward primer: TGTAGTGGGAGATGCTGATAC
Primer 2SCF173212.reverse primer: AATTGGCGAACTAGAAAGTG
Max Length206
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2017LG01N/A20.2SCF173212ViewN/A
2Cranberry-Crimson_Queen-2017LG01N/A16.7SCF173212ViewN/A
3Cranberry-Crimson_Queen-2007LG1N/A16.9SCF173212ViewN/A
4Cranberry-CNJ02-1-2007LG1N/A21.04SCF173212ViewN/A
5Cranberry-Composite_map-F1LG01N/A95.35SCF173212ViewN/A
6Cranberry-Crimson_Queen-F1LG01N/A64.35SCF173212ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278924
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF173212.forward primerVaccinium macrocarponprimer
reverse primerSCF173212.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF173212SCF173212Vaccinium macrocarponmarker_locus
SCF173212SCF173212-95.35Vaccinium macrocarponmarker_locus
SCF173212SCF173212-64.35Vaccinium macrocarponmarker_locus