SCF173212, SCF173212 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Genbank IDKP278924
SpeciesVaccinium macrocarpon
Repeat Motif(TC)9
Primer 1SCF173212.forward primer: TGTAGTGGGAGATGCTGATAC
Primer 2SCF173212.reverse primer: AATTGGCGAACTAGAAAGTG
Max Length206
Publication[view all]
External references for this genetic_marker
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer