SCF192219, SCF192219 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF192219
Genbank IDKP278941
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)9
Primer 1SCF192219.forward primer: GAATTTTGTCGTTCCAGAGA
Primer 2SCF192219.reverse primer: AAAAGAAGAAGAGGAATGGC
Max Length158
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG06N/A90.8SCF192219View
2Cranberry-CNJ02-1-2007LG6N/A99.64SCF192219View
3Cranberry-Mullica_Queen-2017LG06N/A102.4SCF192219View
4Cranberry-Stevens-F1LG06N/A0SCF192219View
5Cranberry-Mullica_Queen-2007LG6N/A116.5SCF192219View
6Cranberry-BB/CQ-F1LG05N/A0SCF192219View
7Cranberry-Mullica_Queen_1-F1LG06N/A0SCF192219View
8Cranberry-Composite_map-F1LG06N/A0.9SCF192219View
9Cranberry-GH1/35-F1LG06N/A1.71SCF192219View
10Cranberry-Mullica_Queen_2-F1LG06N/A1.49SCF192219View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278941
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF192219.forward primerVaccinium macrocarponprimer
reverse primerSCF192219.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF192219SCF192219Vaccinium macrocarponmarker_locus
SCF192219SCF192219-0.9Vaccinium macrocarponmarker_locus
SCF192219SCF192219-1.71Vaccinium macrocarponmarker_locus
SCF192219SCF192219-1.49Vaccinium macrocarponmarker_locus