SCF194552, SCF194552 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF194552
Genbank IDKP278944
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)9
Primer 1SCF194552.forward primer: CACAGGTGTAGGGTCTTGTT
Primer 2SCF194552.reverse primer: AAAAGGAGGCAAGGATAGAG
Max Length238
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2017LG04N/A24.4SCF194552ViewN/A
2Cranberry-Crimson_Queen-2007LG4N/A53.2SCF194552ViewN/A
3Cranberry-Mullica_Queen-2017LG04N/A57.8SCF194552ViewN/A
4Cranberry-CNJ02-1-2007LG4N/A59.41SCF194552ViewN/A
5Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG4N/A62.78SCF194552ViewN/A
6Cranberry-Mullica_Queen-2007LG4N/A65SCF194552ViewN/A
7Cranberry-CNJ02-1-2017LG04N/A56.7SCF194552ViewN/A
8Cranberry-[BG//BL/BN]95-F1LG04N/A52.27SCF194552ViewN/A
9Cranberry-Composite_map-F1LG04N/A45.88SCF194552ViewN/A
10Cranberry-Crimson_Queen-F1LG04N/A47.61SCF194552ViewN/A
11Cranberry-GH1/35-F1LG04N/A42.6SCF194552ViewN/A
12Cranberry-Mullica_Queen_1-F1LG04N/A69.18SCF194552ViewN/A
13Cranberry-Mullica_Queen_2-F1LG04N/A50.9SCF194552ViewN/A
14Cranberry-BB/CQ-F1LG02N/A52.29SCF194552ViewN/A
15Cranberry-BB/CQ-F1LG02N/A66.7SCF194552ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278944
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF194552.forward primerVaccinium macrocarponprimer
reverse primerSCF194552.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF194552SCF194552Vaccinium macrocarponmarker_locus
SCF194552SCF194552-52.27Vaccinium macrocarponmarker_locus
SCF194552SCF194552-45.88Vaccinium macrocarponmarker_locus
SCF194552SCF194552-47.61Vaccinium macrocarponmarker_locus
SCF194552SCF194552-42.6Vaccinium macrocarponmarker_locus
SCF194552SCF194552-69.18Vaccinium macrocarponmarker_locus
SCF194552SCF194552-50.9Vaccinium macrocarponmarker_locus
SCF194552SCF194552-52.285Vaccinium macrocarponmarker_locus
SCF194552SCF194552-66.702Vaccinium macrocarponmarker_locus