SCF174468, SCF174468 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF174468
Genbank IDKP278926
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)13
Primer 1SCF174468.forward primer: CAACATTCTTCGCTCACAA
Primer 2SCF174468.reverse primer: CTAAGAGTTGACATGATTGGC
Max Length178
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG2N/A43.5SCF174468View
2Cranberry-CNJ02-1-2017LG02N/A47.4SCF174468View
3Cranberry-Mullica_Queen-2007LG2N/A54.6SCF174468View
4Cranberry-Mullica_Queen-2017LG02N/A50.5SCF174468View
5Cranberry-CNJ02-1-2007LG2N/A48.87SCF174468View
6Cranberry-Crimson_Queen-2007LG2N/A45SCF174468View
7Cranberry-Crimson_Queen-2017LG02N/A41.5SCF174468View
8Cranberry-Composite_map-F1LG02N/A54.75SCF174468View
9Cranberry-Crimson_Queen-F1LG02N/A57.25SCF174468View
10Cranberry-Mullica_Queen_1-F1LG02N/A65.28SCF174468View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278926
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF174468.forward primerVaccinium macrocarponprimer
reverse primerSCF174468.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF174468SCF174468Vaccinium macrocarponmarker_locus
SCF174468SCF174468-54.75Vaccinium macrocarponmarker_locus
SCF174468SCF174468-57.25Vaccinium macrocarponmarker_locus
SCF174468SCF174468-65.28Vaccinium macrocarponmarker_locus